Sequence ID | >WENV181291944 |
Genome ID | OFHD01012701 |
Search identical group | |
Phylum/Class | [OFHD] soil metagenome; Clay |
Species | |
Start position on genome | 561 |
End posion on genome | 474 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gcgctccggT |
tRNA gene sequence |
GCGTGGGTAGCCAAGCCTGGTCAAAGGCGAGGGACTCAAGATCCCTTCCCGAAGGGGTTC |
Downstream region at tRNA end position |
acctccccag |
Secondary structure (Cloverleaf model) | >WENV181291944 Leu CAA T ATCa acctccccag G - C C - G G - C T - A G - C G - C G - C T A T G G T C C A C C G A A | | | | | G T A C C G C C A G G C G | | | T T G A G G C T C A A G TCCCGAAGGGGTTC A - T G - C G - C G - C A - T C A T G C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |