Sequence ID | >WENV181293149 |
Genome ID | OFHG01000121 |
Search identical group | |
Phylum/Class | [OFHG] soil metagenome; Clay |
Species | |
Start position on genome | 16209 |
End posion on genome | 16281 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
gcacgcccgc |
tRNA gene sequence |
AGCCCCGTGGTGTAGCGGTCAAGCATTCGGGTCTTTGGAACCCGCGACGGCAGTTCGAAT |
Downstream region at tRNA end position |
ccatgaagtc |
Secondary structure (Cloverleaf model) | >WENV181293149 Gln TTG c Atcc ccatgaagtc A - T G - C C - G C - G C - G C - G G - C T A T C C G T C A C G A G | | | | | G G T G T G G G C A G C G + | | + T T T G C A T C A A T CGAC C - G G - C G - C G - C T - A C A T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |