Sequence ID | >WENV181293153 |
Genome ID | OFHG01000130 |
Search identical group | |
Phylum/Class | [OFHG] soil metagenome; Clay |
Species | |
Start position on genome | 15375 |
End posion on genome | 15287 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
accgggctgT |
tRNA gene sequence |
GCGTGGGTGGCCCAGCTTGGTCAAAGGCGCAGCGTTGAGGTCGCTGTCCCGAAGGGGTTC |
Downstream region at tRNA end position |
tcccgttcgg |
Secondary structure (Cloverleaf model) | >WENV181293153 Leu GAG T ATCC tcccgttcgg G - C C - G G - C T - A G - C G - C G - C T A T C G T C C A T C G A G | | | | | A T C C C G G C A G G C G | | | T T G A G G C T C A A G TCCCGAAGGGGTTC C - G A - T G - C C - G G - C T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |