Sequence ID | >WENV181293257 |
Genome ID | OFHG01000749 |
Search identical group | |
Phylum/Class | [OFHG] soil metagenome; Clay |
Species | |
Start position on genome | 10370 |
End posion on genome | 10294 |
Amino Acid | Ile2 |
Anticodon | CAT |
Upstream region at tRNA start position |
ttgcatttcg |
tRNA gene sequence |
GGGCCTATAGCTCAATTGGTTAGAGCAGCGGACTCATAATCCGTTGGTTCCAGGTTCAAG |
Downstream region at tRNA end position |
tttccgctat |
Secondary structure (Cloverleaf model) | >WENV181293257 Ile2 CAT g ACCA tttccgctat G - C G - C G - C C - G C - G T + G A - T T G T G G T C C A T A A A | | | | | A T C T C G C C A G G C G | | | | T T G G A G C T T A A TGGTT G + T C - G G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |