Sequence ID | >WENV181294068 |
Genome ID | OFHG01069447 |
Search identical group | |
Phylum/Class | [OFHG] soil metagenome; Clay |
Species | |
Start position on genome | 400 |
End posion on genome | 327 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
tctcaatcgc |
tRNA gene sequence |
TGCCCCCTCGTTCAATGGTAGGACAGCTGACTCTGGATCAGCATATCGGGGTTCGAATCC |
Downstream region at tRNA end position |
aagattctaa |
Secondary structure (Cloverleaf model) | >WENV181294068 Gln CTG c GCCA aagattctaa T - A G - C C - G C - G C - G C - G C - G T A T G T C C C A A A C | + | | | G T C T T G C G G G G C G | + | | T T G G G A C T A A ATAT G - C C - G T - A G - C A - T C A T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |