Sequence ID | >WENV181297040 |
Genome ID | OFHK01006190 |
Search identical group | |
Phylum/Class | [OFHK] soil metagenome; Clay |
Species | |
Start position on genome | 596 |
End posion on genome | 672 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
cacgtgaaat |
tRNA gene sequence |
GCACCCTTAGCTCAGCTGGATAGAGCGTTGCCCTCCGAAGGCAAAGGCCAGTGGTTCGAA |
Downstream region at tRNA end position |
cctttcccct |
Secondary structure (Cloverleaf model) | >WENV181297040 Arg CCG t GCCA cctttcccct G - C C - G A - T C - G C - G C - G T - A T A T T C A C C A C G A A | | | | | G T C T C G A G T G G C G | | | | T T G G A G C A T A G AGGCC T - A T - A G - C C - G C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |