Sequence ID | >WENV181306060 |
Genome ID | OFIJ01002775 |
Search identical group | |
Phylum/Class | [OFIJ] marine metagenome; seawater |
Species | |
Start position on genome | 192 |
End posion on genome | 267 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
taaagtctat |
tRNA gene sequence |
GCCGCCCTAGCTCAGCGTGGTAGAGCGTCGGACTGTTAATCCGTTGGTCGTCAGTTCAAG |
Downstream region at tRNA end position |
aatatttcta |
Secondary structure (Cloverleaf model) | >WENV181306060 Asn GTT t GCCt aatatttcta G - C C - G C - G G - C C - G C - G C - G T G T C A G T C A C G A A | | | | | A G C T C G G T C A G C T | | | | T T G G A G C G T A G TGGTC T T C - G G - C G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |