Sequence ID | >WENV181311284 |
Genome ID | OFJB01000560 |
Search identical group | |
Phylum/Class | [OFJB] sludge metagenome; sludge |
Species | |
Start position on genome | 17737 |
End posion on genome | 17661 |
Amino Acid | fMet |
Anticodon | CAT |
Upstream region at tRNA start position |
nnnnnnnnnn |
tRNA gene sequence |
CGCGCGATGGAGCAGTCTGGTAGCTCGTTGGGCTCATAACCCAAAGGTCGGAGGTTCAAA |
Downstream region at tRNA end position |
ggtttctgat |
Secondary structure (Cloverleaf model) | >WENV181311284 fMet CAT n ACCA ggtttctgat C A G - C C - G G - C C - G G - C A - T T A T C C T C C A T G A G | | | | | A C C G A G G G A G G C T | | | | T T G G C T C G T A G AGGTC T - A T - A G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |