Sequence ID | >WENV181311359 |
Genome ID | OFJB01001074 |
Search identical group | |
Phylum/Class | [OFJB] sludge metagenome; sludge |
Species | |
Start position on genome | 6117 |
End posion on genome | 6043 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
cggtggttcc |
tRNA gene sequence |
GGGCGTGTAGCTCAGCGGGAGAGCACTACGTTGACATCGTAGGGGTCACAGGTTCGATCC |
Downstream region at tRNA end position |
ccccctcctc |
Secondary structure (Cloverleaf model) | >WENV181311359 Val GAC c ACCA ccccctcctc G - C G - C G - C C - G G - C T - A G - C C T T T G T C C A G A A | | | | | G C C T C G A C A G G C G | | | | T T G G A G C G A A GGGTC C - G T - A A - T C - G G - C T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |