Sequence ID | >WENV181311565 |
Genome ID | OFJB01004569 |
Search identical group | |
Phylum/Class | [OFJB] sludge metagenome; sludge |
Species | |
Start position on genome | 4149 |
End posion on genome | 4223 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
gctgccttgc |
tRNA gene sequence |
CTCCTCGTAGTTCAATGGATAGAACGAGTGCCTCCTAAGCGCTAGATACAGGTTCGATTC |
Downstream region at tRNA end position |
gcttcatcgc |
Secondary structure (Cloverleaf model) | >WENV181311565 Arg CCT c ACCA gcttcatcgc C - G T + G C - G C - G T - A C - G G - C T T T T G T C C A T A A A | | | | | G G C T T G A C A G G C G | | | | T T A G A A C T A G AGAT A - T G - C T + G G - C C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |