Sequence ID | >WENV181311855 |
Genome ID | OFJB01016423 |
Search identical group | |
Phylum/Class | [OFJB] sludge metagenome; sludge |
Species | |
Start position on genome | 1837 |
End posion on genome | 1740 |
Amino Acid | SeC |
Anticodon | TCA |
Upstream region at tRNA start position |
tacagtacca |
tRNA gene sequence |
GGAGGTACGTCGGGCGCTGGTGGCCCGCGCGGTCTTCAAAACCGTTGAGAGGGGTGAGAA |
Downstream region at tRNA end position |
tacacaaaaa |
Secondary structure (Cloverleaf model) | >WENV181311855 SeC TCA a GCCA tacacaaaaa G - C G - C A - T G - C G - C T - A A - T C - G T T G T G T C C A C G C T + | | | | G T G G G C G C A G G C G | | | | T T G C C C G T G G C TGAGAGGGGTGAGAAACTCCTTTG G + T C - G G - C G - C T - A C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |