Sequence ID | >WENV181323529 |
Genome ID | OFKY01003773 |
Search identical group | |
Phylum/Class | [OFKY] marine metagenome; sea ice |
Species | |
Start position on genome | 686 |
End posion on genome | 611 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
gaaaaccttc |
tRNA gene sequence |
GGGACGTTAGCTCAGTTGGTAGAGCAGCGGACTTTTAATCCGTTTGTCGTGGGTTCGACC |
Downstream region at tRNA end position |
ctagatacaa |
Secondary structure (Cloverleaf model) | >WENV181323529 Lys TTT c ACCA ctagatacaa G - C G - C G - C A - T C - G G - C T - A C C T C G C C C A T G A A | + | | | G T C T C G G T G G G C G | | | | T T G G A G C T A A TTGTC G + T C - G G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |