Sequence ID | >WENV181324070 |
Genome ID | OFLB01002215 |
Search identical group | |
Phylum/Class | [OFLB] marine metagenome; seawater |
Species | |
Start position on genome | 215 |
End posion on genome | 139 |
Amino Acid | Ile2 |
Anticodon | CAT |
Upstream region at tRNA start position |
tagtatatcT |
tRNA gene sequence |
GCACTGATGGCAGAACGGTTAATGCAACGAGCTCATGACTCGTCATATTTCTCGGTTCGA |
Downstream region at tRNA end position |
taattaaagc |
Secondary structure (Cloverleaf model) | >WENV181324070 Ile2 CAT T AAtt taattaaagc G + T C - G A - T C - G T - A G - C A - T T A T G G G C C A C A A G | + | | | G G G A C G C T C G G C G | | | T T T A T G C T A A CATATTT A - T C - G G - C A - T G - C C A T G C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |