| Sequence ID | >WENV181325014 |
| Genome ID | OFLI01001534 |
| Phylum/Class | [OFLI] seawater metagenome; seawater |
| Species | |
| Start position on genome | 1288 |
| End posion on genome | 1363 |
| Amino Acid | Lys |
| Anticodon | CTT |
| Upstream region at tRNA start position |
ttgcgctgat |
| tRNA gene sequence |
GCGCCTCTAGCTCAATTGGCAGAGCAACTGACTCTTAATCAGTGGGTTCCCGGTTCAAGT |
| Downstream region at tRNA end position |
gaaaaaaatc |
| Secondary structure (Cloverleaf model) | >WENV181325014 Lys CTT
t ACCA gaaaaaaatc
G - C
C - G
G - C
C - G
C - G
T + G
C - G T G
T G G G C C A
T A A A | | | | | A
T C T C G C C C G G C
G | | | | T T
G G A G C
C A A GGGTT
A - T
C - G
T - A
G - C
A - T
C A
T A
C T T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |