| Sequence ID | >WENV181325029 |
| Genome ID | OFLI01002382 |
| Phylum/Class | [OFLI] seawater metagenome; seawater |
| Species | |
| Start position on genome | 1016 |
| End posion on genome | 927 |
| Amino Acid | Ser |
| Anticodon | GGA |
| Upstream region at tRNA start position |
accagtagct |
| tRNA gene sequence |
GGAGAGATGGCTGAGCGGTTTAAAGCGCACGCTTGGAAAGTGTGTGTACTGTTAAAGGTA |
| Downstream region at tRNA end position |
aaaaattaaa |
| Secondary structure (Cloverleaf model) | >WENV181325029 Ser GGA
t GCCA aaaaattaaa
G - C
G - C
A - T
G - C
A - T
G - C
A - T T A
T G T C C C A
C G A G | | | | | G
G G T C G C A G G G C
G | | | T T
T A A G C
T T A G TGTACTGTTAAAGGTACC
C - G
A - T
C - G
G + T
C - G
T A
T A
G G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |