Sequence ID | >WENV181325649 |
Genome ID | OFLJ01010891 |
Search identical group | |
Phylum/Class | [OFLJ] seawater metagenome; seawater |
Species | |
Start position on genome | 628 |
End posion on genome | 704 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
agatgaaaat |
tRNA gene sequence |
CGGGGTATAGCGCAGTCTGGTAGCGCGCCTGCTTTGGGAGCAGGATGTCGGGAGTTCGAA |
Downstream region at tRNA end position |
attttttggg |
Secondary structure (Cloverleaf model) | >WENV181325649 Pro TGG t ACCA attttttggg C - G G - C G - C G - C G - C T - A A - T T A T C T C T C A T G A A | + | | | G C C G C G G G G A G C T | | | | T T G G C G C G T A G ATGTC C - G C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |