Sequence ID | >WENV181325691 |
Genome ID | OFLJ01014975 |
Search identical group | |
Phylum/Class | [OFLJ] seawater metagenome; seawater |
Species | |
Start position on genome | 393 |
End posion on genome | 320 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
tactgtagtT |
tRNA gene sequence |
TGGGGCATAGCCAAGTGGTAAGGCGACGGTTTTTGGCTCCGTTATCCGGAGGTTCGAGTC |
Downstream region at tRNA end position |
aaaggaaatt |
Secondary structure (Cloverleaf model) | >WENV181325691 Gln TTG T GTaa aaaggaaatt T - A G - C G - C G - C G - C C - G A - T T G T C T T C C A G A A | + | | | G T A C C G G G A G G C G | | | T T G A G G C T A G TATCC A - T C - G G - C G - C T T T C T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |