Sequence ID | >WENV181325762 |
Genome ID | OFLJ01023527 |
Search identical group | |
Phylum/Class | [OFLJ] seawater metagenome; seawater |
Species | |
Start position on genome | 400 |
End posion on genome | 473 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
agttgcaaac |
tRNA gene sequence |
GGCTCCATCGTTTAGCGGCCTAGGACGCTGCCCTCTCACGGCAGTAGCGCGGGTTCGAAT |
Downstream region at tRNA end position |
attctcgctt |
Secondary structure (Cloverleaf model) | >WENV181325762 Glu CTC c ACaa attctcgctt G - C G + T C - G T - A C - G C - G A - T T A T C G C C C A C G A C | | | | | G G T T T G G C G G G C G + + | | T T C G G A C C T A G TAGC C - G T - A G - C C - G C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |