| Sequence ID | >WENV181325858 |
| Genome ID | OFLJ01035867 |
| Phylum/Class | [OFLJ] seawater metagenome; seawater |
| Species | |
| Start position on genome | 291 |
| End posion on genome | 366 |
| Amino Acid | Phe |
| Anticodon | GAA |
| Upstream region at tRNA start position |
gactgtgcgt |
| tRNA gene sequence |
GGTCTGATAGCTCAGTTGGTAGAGCAGAGCCCTGAAAAGGCTTGTGTCGGTGGTTCAAGT |
| Downstream region at tRNA end position |
gtttttgttt |
| Secondary structure (Cloverleaf model) | >WENV181325858 Phe GAA
t ACCA gtttttgttt
G - C
G - C
T - A
C - G
T - A
G - C
A - T T G
T C C A C C A
T G A A | | | | | A
T C T C G G G T G G C
G | | | | T T
G G A G C
T A A GTGTC
G + T
A - T
G - C
C - G
C - G
C A
T A
G A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |