Sequence ID | >WENV181328703 |
Genome ID | OFLU01006573 |
Search identical group | |
Phylum/Class | [OFLU] metagenome; faeces |
Species | |
Start position on genome | 543 |
End posion on genome | 468 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
tcgtaatgat |
tRNA gene sequence |
GCTGGCGTAGCTCAATAGGTAGAGCAGCTGACTTGTAATCAGCAGGTTGTGGGTTCAATT |
Downstream region at tRNA end position |
ttttatttat |
Secondary structure (Cloverleaf model) | >WENV181328703 Thr TGT t TCCA ttttatttat G - C C - G T - A G - C G - C C - G G - C T T T T A T C C A T A A A + | + | | A A C T C G G T G G G C G | | | | T T G G A G C T A A AGGTT G - C C - G T - A G - C A - T C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |