Sequence ID | >WENV181345271 |
Genome ID | OFML01000013 |
Search identical group | |
Phylum/Class | [OFML] human gut metagenome; human gut |
Species | |
Start position on genome | 188969 |
End posion on genome | 189045 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
ctgtattagT |
tRNA gene sequence |
GGGACCGTAGGGTAGCTTGGTCGATCCTTTGGGCTTTGGGAGCCTGAGACTCCGGTTCAA |
Downstream region at tRNA end position |
ttatgtcccg |
Secondary structure (Cloverleaf model) | >WENV181345271 Pro TGG T ATtt ttatgtcccg G - C G - C G - C A - T C - G C - G G - C T A T G G G C C A T C G A A + | | | | A T T G G G T C C G G C G | | + T T G T C C T T C G A T AGAC T + G G + T G - C G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |