| Sequence ID | >WENV181346685 |
| Genome ID | OFMM01000013 |
| Phylum/Class | [OFMM] human gut metagenome; human gut |
| Species | |
| Start position on genome | 109101 |
| End posion on genome | 109173 |
| Amino Acid | Val |
| Anticodon | TAC |
| Upstream region at tRNA start position |
gatgtactat |
| tRNA gene sequence |
GGTTCCGTGGTCTAGTGGTATGATACCTCCCTTACAAGGAGGGGATCACGAGTTCGAATC |
| Downstream region at tRNA end position |
cttaactatt |
| Secondary structure (Cloverleaf model) | >WENV181346685 Val TAC
t ACtt cttaactatt
G - C
G - C
T - A
T - A
C - G
C - G
G - C T A
T T G C T C A
G A G | | | | | G
T T C T G A C G A G C
G | | + T T
G T G A T
T A A GGATC
C - G
C - G
T - A
C - G
C - G
C A
T A
T A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |