Sequence ID | >WENV181347310 |
Genome ID | OFMM01002200 |
Search identical group | |
Phylum/Class | [OFMM] human gut metagenome; human gut |
Species | |
Start position on genome | 2889 |
End posion on genome | 2814 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
ccagtaatgT |
tRNA gene sequence |
GCGATCGTAGCTCAGCTGGATAGAGCGTTCGGCTCCGACCCGGAAGGCCAGAGGTTCGAA |
Downstream region at tRNA end position |
gttaataaaa |
Secondary structure (Cloverleaf model) | >WENV181347310 Arg CCG T ATgt gttaataaaa G - C C - G G - C A - T T + G C - G G - C T A T C C T C C A C G A A | | | | G T C T C G A G A G G C G | | | | T T G G A G C A T A G AGGCC T - A T + G C - G G - C G - C C C T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |