Sequence ID | >WENV181360811 |
Genome ID | OFNB01000222 |
Search identical group | |
Phylum/Class | [OFNB] sediment metagenome; Lake sediment |
Species | |
Start position on genome | 976 |
End posion on genome | 1062 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
tacacttttT |
tRNA gene sequence |
GCTGAGGTAGTCTAGCGGTAGGGCGCAGGCCTGGAAAGCCTGTGGTGCGAAAGTGCCTCG |
Downstream region at tRNA end position |
gattattccc |
Secondary structure (Cloverleaf model) | >WENV181360811 Ser GGA T GTCt gattattccc G - C C - G T - A G - C A - T G - C G - C T T T C C C C C A G A A | | | | | A C T C T G G G G G G C G + | + | T T G G G G C T A G TGGTGCGAAAGTGCCTC C - G A - T G - C G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |