| Sequence ID | >WENV181361770 |
| Genome ID | OFOI01000139 |
| Phylum/Class | [OFOI] sediment metagenome; Lake sediment |
| Species | |
| Start position on genome | 187 |
| End posion on genome | 273 |
| Amino Acid | Ser |
| Anticodon | CGA |
| Upstream region at tRNA start position |
agaaccggtT |
| tRNA gene sequence |
GCCGAGGTAGTCTAGCCCGGGAAGGCGGTAGCCTCGAAAGCTACTGGCGCTTCGCGCCTC |
| Downstream region at tRNA end position |
ttgttatgtt |
| Secondary structure (Cloverleaf model) | >WENV181361770 Ser CGA
T GTtt ttgttatgtt
G - C
C - G
C - G
G - C
A - T
G - C
G - C T A
T C C C T C A
C G A A | | | | | A
C T C T G G G G A G C
C | | + | T T
G A G G C
G G A G TGGCGCTTCGCGCCTC
G - C
T - A
A - T
G - C
C - G
C A
T A
C G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |