Sequence ID | >WENV181364954 |
Genome ID | OFPG01000463 |
Search identical group | |
Phylum/Class | [OFPG] sediment metagenome; Lake sediment |
Species | |
Start position on genome | 3406 |
End posion on genome | 3331 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
caaaggttat |
tRNA gene sequence |
GACCCCATCGTCTAGAGGCCTAGGACACTACCCTTTCACGGTAGGTACCGGGGTTCGAAT |
Downstream region at tRNA end position |
aattcatcat |
Secondary structure (Cloverleaf model) | >WENV181364954 Glu TTC t GCCA aattcatcat G - C A - T C - G C - G C - G C - G A - T T A T G C C C C A A G A C | | | | | G G T C T G C G G G G C G + | | | T T C G G A C C T A A GTAC C - G T - A A - T C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |