| Sequence ID | >WENV181365027 |
| Genome ID | OFPI01000002 |
| Phylum/Class | [OFPI] sediment metagenome; Lake sediment |
| Species | |
| Start position on genome | 4513 |
| End posion on genome | 4437 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
ccggccgatt |
| tRNA gene sequence |
GGTGATATAGCTCAGTTGGTTAGAGCGCAGCATTCATAATGCTGATGTCGGTGGTTCAAA |
| Downstream region at tRNA end position |
aatcttgaga |
| Secondary structure (Cloverleaf model) | >WENV181365027 Met CAT
t ACCA aatcttgaga
G - C
G - C
T - A
G - C
A - T
T - A
A - T T A
T C C A C C A
T G A A | | | | | A
T C T C G G G T G G C
G | | | | T T
G G A G C
T T A G ATGTC
C - G
A - T
G - C
C - G
A - T
T A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |