| Sequence ID | >WENV181369002 |
| Genome ID | OFQN01008244 |
| Phylum/Class | [OFQN] freshwater metagenome; Freshwater Lake |
| Species | |
| Start position on genome | 19 |
| End posion on genome | 94 |
| Amino Acid | Asn |
| Anticodon | GTT |
| Upstream region at tRNA start position |
aaccgaatat |
| tRNA gene sequence |
TCCTCGATAGCTCAGTCGGTAGAGCGCCGGACTGTTAATCCGTAGGTCCCTGGTTCGAGC |
| Downstream region at tRNA end position |
aaaccccttt |
| Secondary structure (Cloverleaf model) | >WENV181369002 Asn GTT
t GCCA aaaccccttt
T - A
C - G
C - G
T - A
C - G
G - C
A - T C G
T G G A C C A
T G A A | | | | | G
C C T C G C C T G G C
G | | | | T T
G G A G C
T A G AGGTC
C T
C - G
G - C
G - C
A - T
C A
T A
G T T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |