| Sequence ID | >WENV181390835 |
| Genome ID | OFRQ01000338 |
| Phylum/Class | [OFRQ] seawater metagenome; seawater |
| Species | |
| Start position on genome | 889 |
| End posion on genome | 962 |
| Amino Acid | Gly |
| Anticodon | TCC |
| Upstream region at tRNA start position |
ttgatgttgt |
| tRNA gene sequence |
GCGGGTGTAGTTCAATGGTAGAACGCTAGCCTTCCAAGCTGGATGTAAGAGTTCGATTCT |
| Downstream region at tRNA end position |
agaaaaaaag |
| Secondary structure (Cloverleaf model) | >WENV181390835 Gly TCC
t TCCA agaaaaaaag
G - C
C - G
G - C
G - C
G - C
T - A
G + T T T
T T T C T C A
A A A | | | | | G
T C T T G A A G A G C
G | | | | T T
G G A A C
T A G ATGT
C - G
T + G
A - T
G - C
C - G
C A
T A
T C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |