Sequence ID | >WENV181392543 |
Genome ID | OFRW01078235 |
Search identical group | |
Phylum/Class | [OFRW] seawater metagenome; seawater |
Species | |
Start position on genome | 238 |
End posion on genome | 314 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
ggatagaaat |
tRNA gene sequence |
GGTCCCGTAGCTCAGCTGGATAGAGTACTCGCCTCCGAAGCGAGGGGTCACAGGTTCAAA |
Downstream region at tRNA end position |
agatttaaat |
Secondary structure (Cloverleaf model) | >WENV181392543 Arg CCG t ACCA agatttaaat G - C G - C T - A C - G C - G C - G G - C T A T T G T C C A C G A A | | | | | A T C T C G A C A G G C G | | | + T T G G A G T A T A A GGGTC C - G T - A C - G G - C C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |