Sequence ID | >WENV181400923 |
Genome ID | OFSF01033001 |
Search identical group | |
Phylum/Class | [OFSF] wastewater metagenome; Exp Tend VB 100WW |
Species | |
Start position on genome | 524 |
End posion on genome | 449 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
cactttatat |
tRNA gene sequence |
AGGGGATTCGCCAAGTCGGTAAGGCATAGCACTTTGACTGCTACATGCGTAGGTTCGAGT |
Downstream region at tRNA end position |
aatgaatatt |
Secondary structure (Cloverleaf model) | >WENV181400923 Gln TTG t GCCA aatgaatatt A - T G - C G - C G - C G - C A - T T - A T G T C G T C C A T G A C | + | | | G C A C C G G T A G G C G | | | T T G A G G C T A A CATGC T - A A - T G - C C - G A - T C C T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |