Sequence ID | >WENV181405169 |
Genome ID | OGCB01020939 |
Search identical group | |
Phylum/Class | [OGCB] hot springs metagenome; Octopus Spring Streamers, Yellowstone National Park, Wyoming, USA |
Species | |
Start position on genome | 192 |
End posion on genome | 278 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
aaatagtaaa |
tRNA gene sequence |
GCCGGAGTGGCGGAATTGGCAGACGCGCTGTCTTGAGGGGGCAGTGCCCGAAAGGGCGTG |
Downstream region at tRNA end position |
agaacaatga |
Secondary structure (Cloverleaf model) | >WENV181405169 Leu GAG a ACCA agaacaatga G - C C - G C - G G - C G - C A - T G - C T C T C G C C C A T A A G | | | | | G T G G C G G C G G G C G | | | T T G A C G C C A G G TGCCCGAAAGGGCGT C - G T - A G - C T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |