Sequence ID | >WENV181406810 |
Genome ID | OGCG01001572 |
Search identical group | |
Phylum/Class | [OGCG] hot springs metagenome; Joseph's Coat, Yellowstone National Park, Washington, USA |
Species | |
Start position on genome | 963 |
End posion on genome | 1050 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
aactcctggc |
tRNA gene sequence |
GCGGGGGTGCCCGAGCCTGGTCAAAGGGGTCGGGCTGAGGGCCCGATGGCGTAGGCCTGC |
Downstream region at tRNA end position |
cctctgcaaa |
Secondary structure (Cloverleaf model) | >WENV181406810 Leu GAG c ACCA cctctgcaaa G - C C - G G - C G - C G - C G - C G - C G A T C A C C C A C C G A G | | | | | G T G C C C G T G G G C G | | | T T G A G G G T C A A G TGGCGTAGGCCTGC T - A C - G G - C G - C G - C C G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |