Sequence ID | >WENV181407342 |
Genome ID | OGCG01018543 |
Search identical group | |
Phylum/Class | [OGCG] hot springs metagenome; Joseph's Coat, Yellowstone National Park, Washington, USA |
Species | |
Start position on genome | 188 |
End posion on genome | 271 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tatatagata |
tRNA gene sequence |
GCCGGAGTGGTGAAATTGGCAGACACGCTATCTTGAGGGGGTAGTCCTCGCAAGAGGGTG |
Downstream region at tRNA end position |
aattttacta |
Secondary structure (Cloverleaf model) | >WENV181407342 Leu GAG a Attt aattttacta G - C C - G C - G G - C G - C A - T G - C T G T C G C C C A T A A G | | | | | G T A G T G G C G G G C G | | | T T G A C A C C A G G TCCTCGCAAGAGGGT C - G T - A A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |