Sequence ID | >WENV181407859 |
Genome ID | OGCH01000139 |
Search identical group | |
Phylum/Class | [OGCH] hot springs metagenome; hot springs |
Species | |
Start position on genome | 5472 |
End posion on genome | 5397 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
aagacgaggt |
tRNA gene sequence |
GGGGCCGTAGCTCAGCTGGGAGAGCGCTACCATGGCACGGTAGAGGTCGTGGGTTCAAGT |
Downstream region at tRNA end position |
gcgggggccc |
Secondary structure (Cloverleaf model) | >WENV181407859 Ala GGC t ACCA gcgggggccc G - C G - C G + T G - C C - G C - G G - C T G T T A C C C A C G A A + | | | | A T C T C G G T G G G C G | | | | T T G G A G C G A G AGGTC C - G T - A A - T C - G C - G A C T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |