| Sequence ID | >WENV181408750 |
| Genome ID | OGCH01011833 |
| Phylum/Class | [OGCH] hot springs metagenome; hot springs |
| Species | |
| Start position on genome | 4 |
| End posion on genome | 78 |
| Amino Acid | Ile2 |
| Anticodon | CAT |
| Upstream region at tRNA start position |
nnnnnnngat |
| tRNA gene sequence |
GGGCCCATAGCTCAACGGTAGAGCTGCCTGCTCATAACCGGTCGGTTCCTGGTTCGAATC |
| Downstream region at tRNA end position |
tgggcgaata |
| Secondary structure (Cloverleaf model) | >WENV181408750 Ile2 CAT
t ACCA tgggcgaata
G - C
G - C
G - C
C - G
C - G
C - G
A - T T A
T G G G C C A
A A A | | + | | G
C C T C G C C T G G C
G | | | | T T
G G A G C
T A T CGGTT
G + T
C - G
C - G
T C
G - C
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |