Sequence ID | >WENV181413260 |
Genome ID | OGCK01045134 |
Search identical group | |
Phylum/Class | [OGCK] hot springs metagenome; hot spring sediment |
Species | |
Start position on genome | 355 |
End posion on genome | 440 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ttcgattagc |
tRNA gene sequence |
GCGGGGGTAACCAAGCCAGGTCAACGGTGATAGACTCAAGATCTATTCTCGCAGGAGTTC |
Downstream region at tRNA end position |
ccgctaccgt |
Secondary structure (Cloverleaf model) | >WENV181413260 Leu CAA c ACtc ccgctaccgt G - C C - G G - C G - C G - C G - C G - C T A T T T C C C A C C G A A | | | | | G A A C C A A A G G G C G | | | T T G C G G T T C A A G TCTCGCAGGAGTTC A - T T - A A - T G - C A - T C A T G C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |