Sequence ID | >WENV181425056 |
Genome ID | OGCQ01000118 |
Search identical group | |
Phylum/Class | [OGCQ] human gut metagenome; human gut |
Species | |
Start position on genome | 51369 |
End posion on genome | 51295 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
acacgagttt |
tRNA gene sequence |
GGCCCCGTAGCTCAGCTGGATAGAGCATGTGACTTCTAATCTCAAGGTCGACGGTTCGAG |
Downstream region at tRNA end position |
tgtaataagc |
Secondary structure (Cloverleaf model) | >WENV181425056 Arg TCT t ACga tgtaataagc G - C G + T C - G C - G C - G C - G G - C C G T C T G C C A C G A A | | | | | G T C T C G G A C G G C G | | | | T T G G A G C A T A A AGGTC T - A G - C T T G - C A - T C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |