Sequence ID | >WENV181445534 |
Genome ID | OGDS01005588 |
Search identical group | |
Phylum/Class | [OGDS] metagenome; Human gut stool |
Species | |
Start position on genome | 1644 |
End posion on genome | 1719 |
Amino Acid | fMet |
Anticodon | CAT |
Upstream region at tRNA start position |
aactaaatat |
tRNA gene sequence |
CGCGGGGTAGAGCAGTTGGTAGCTCGTCGGGCTCATAACCCGGAGGTCGCAGGTTCAAGT |
Downstream region at tRNA end position |
acaaaagtgc |
Secondary structure (Cloverleaf model) | >WENV181445534 fMet CAT t ACCA acaaaagtgc C A G - C C - G G - C G - C G - C G - C T G T T G T C C A T G A A + | | | | A T C G A G G C A G G C G | | | | T T G G C T C T A G AGGTC T + G C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |