Sequence ID | >WENV181452162 |
Genome ID | OGDZ01000113 |
Search identical group | |
Phylum/Class | [OGDZ] metagenome; Human gut stool |
Species | |
Start position on genome | 15891 |
End posion on genome | 15972 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
tacacagaat |
tRNA gene sequence |
GCCCAGGTGGCGGAATGGTAGACGCGCACGTTTCAGGTGCGTGTGTCGAGAGGCATGCAG |
Downstream region at tRNA end position |
tactcctcaa |
Secondary structure (Cloverleaf model) | >WENV181452162 Leu CAG t ACtt tactcctcaa G - C C - G C - G C - G A - T G - C G + T T G T T G T C C A T A A G + | | | | G G G G C G G C A G G C G | | | T T T A C G C A G G TGTCGAGAGGCAT C - G A - T C - G G - C T + G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |