Sequence ID | >WENV181465537 |
Genome ID | OGEQ01000039 |
Search identical group | |
Phylum/Class | [OGEQ] metagenome; Human gut stool |
Species | |
Start position on genome | 55841 |
End posion on genome | 55927 |
Amino Acid | Leu |
Anticodon | AAG |
Upstream region at tRNA start position |
taaaatacaT |
tRNA gene sequence |
GCGGAAGTGTCGGAACTGGCAGACGAGCAAGACTAAGGATCTTGTGATTATTGCAATCGT |
Downstream region at tRNA end position |
taaaactaaa |
Secondary structure (Cloverleaf model) | >WENV181465537 Leu AAG T ATta taaaactaaa G - C C - G G - C G - C A - T A - T G - C T G T T A C C C A C A A G + | | | | A T G G C T G T G G G C G | | | T T G A C G A C A G G TGATTATTGCAATCGT C - G A - T A - T G - C A - T C A T G A A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |