Sequence ID | >WENV181471872 |
Genome ID | OGEY01012216 |
Search identical group | |
Phylum/Class | [OGEY] metagenome; Human gut stool |
Species | |
Start position on genome | 243 |
End posion on genome | 328 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
tcgattgtct |
tRNA gene sequence |
GCGAGCGTGGCGGAATGGTAGACGCGCTGTCTTCAGGTGGCAGTGAGTGTATGCTCGTGG |
Downstream region at tRNA end position |
tggtgaaagg |
Secondary structure (Cloverleaf model) | >WENV181471872 Leu CAG t ACCA tggtgaaagg G - C C - G G - C A - T G - C C - G G - C T C T C C C C C A T A A G | | | | | A G G G C G G G G G G C G | | | T T T A C G C A G G TGAGTGTATGCTCGT C - G T - A G - C T + G C - G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |