Sequence ID | >WENV181475921 |
Genome ID | OGFE01002919 |
Search identical group | |
Phylum/Class | [OGFE] metagenome; Human gut stool |
Species | |
Start position on genome | 1004 |
End posion on genome | 1078 |
Amino Acid | Ile2 |
Anticodon | CAT |
Upstream region at tRNA start position |
aggatacatc |
tRNA gene sequence |
GGGCTTATAGCTCAGTTGGTTAGAGCAACAGACTCATAATCTGGAGGTCCTAGGTTCAAG |
Downstream region at tRNA end position |
aaatcgacta |
Secondary structure (Cloverleaf model) | >WENV181475921 Ile2 CAT c ACtg aaatcgacta G - C G - C G - C C - G T + G T T A - T C G T G A T C C A T G A A | | | | | A T C T C G C T A G G C G | | | | T T G G A G C T T A A AGGTC A G C - G A - T G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |