Sequence ID | >WENV181489172 |
Genome ID | OGFS01002038 |
Search identical group | |
Phylum/Class | [OGFS] metagenome; Human gut stool |
Species | |
Start position on genome | 343 |
End posion on genome | 418 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ctccaaagat |
tRNA gene sequence |
GCGTCATTAGCTCAGTTGGTAGAGCACACGACTTTTAATCGTGTTGCCACAGGTTCAAAT |
Downstream region at tRNA end position |
tttatgtgtc |
Secondary structure (Cloverleaf model) | >WENV181489172 Lys TTT t ACCA tttatgtgtc G - C C - G G - C T - A C - G A - T T - A T A T T G T C C A T G A A | | | | | A T C T C G A C A G G C G | | | | T T G G A G C T A A TTGCC C - G A - T C - G G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |