Sequence ID | >WENV181492665 |
Genome ID | OGFY01040646 |
Search identical group | |
Phylum/Class | [OGFY] metagenome; Human gut stool |
Species | |
Start position on genome | 446 |
End posion on genome | 370 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
gcacccagac |
tRNA gene sequence |
GTCCCCATCGTCTAGCCGGCCCAGGACAACGGCCTTTCACGCCGTCGACAGGGGTTCAAA |
Downstream region at tRNA end position |
attgaattca |
Secondary structure (Cloverleaf model) | >WENV181492665 Glu TTC c GCCA attgaattca G - C T - A C - G C - G C - G C - G A - T T A T T C C C C A C C G A C | | | | | A G T C T G A G G G G C G + | | | T T C G G A C C C A A CGAC A - T C - G G - C G - C C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |