Sequence ID | >WENV181496551 |
Genome ID | OGGD01002538 |
Search identical group | |
Phylum/Class | [OGGD] metagenome; Human gut stool |
Species | |
Start position on genome | 4326 |
End posion on genome | 4232 |
Amino Acid | SeC |
Anticodon | TCA |
Upstream region at tRNA start position |
tttcaataac |
tRNA gene sequence |
GGAAGGTCGTCATCTCCGGTGAGGTGGCAGGACTTCAAATCCTGTTGGGGACGCCAGCGT |
Downstream region at tRNA end position |
cttttttcct |
Secondary structure (Cloverleaf model) | >WENV181496551 SeC TCA c GCCA cttttttcct G - C G - C A - T A - T G - C G - C T - A C - G T C G T A C C C A C C T T + | | | | A G C T A C G T G G G C G | + | | T T T G G T G G A G TTGGGGACGCCAGCGTTCCCGG C - G A - T G - C G - C A - T C A T A T C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |