Sequence ID | >W141148470 |
Genome ID | AWXZ01000003 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Lutibaculum baratangense AMV1 [AWXZ] |
Start position on genome | 17 |
End posion on genome | 93 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tgcgcacctt |
tRNA gene sequence |
AGGAGTGTAGCTCAACTGGCTAGAGCACCGGTCTCCAAAACCGGGGGTTGGGGGTTCGAG |
Downstream region at tRNA end position |
gttccgtcaa |
Secondary structure (Cloverleaf model) | >W141148470 Trp CCA t GCCA gttccgtcaa A - T G - C G - C A - T G - C T - A G - C T G T C T C C C A C A A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C C T A A GGGTT C - G C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |