Sequence ID | >WENV181516578 |
Genome ID | OGGZ01000070 |
Search identical group | |
Phylum/Class | [OGGZ] metagenome; Human gut stool |
Species | |
Start position on genome | 25370 |
End posion on genome | 25298 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
ttaaaacaac |
tRNA gene sequence |
GCACCCGTAGTTCAATGGATAGAATACCGGATTCCGGTTCCGACGATATGAGTTCGATTC |
Downstream region at tRNA end position |
atttagcaat |
Secondary structure (Cloverleaf model) | >WENV181516578 Arg CCG c ACga atttagcaat G + T C - G A - T C - G C - G C - G G - C T T T T A C T C A T A A A | | | | | G G C T T G A T G A G C G | | | + T T A G A A T T A A CGAT C A C - G G - C G - C A - T T T T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |