Sequence ID | >WENV181524174 |
Genome ID | OGHH01005552 |
Search identical group | |
Phylum/Class | [OGHH] metagenome; Human gut stool |
Species | |
Start position on genome | 786 |
End posion on genome | 706 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
aaagtggttc |
tRNA gene sequence |
GCGGGTGTGGCGGAATTGGCAGACGCGCTAGATTTAGGTTCTAGTGTCCCCGACGTGCAG |
Downstream region at tRNA end position |
tttgaaaata |
Secondary structure (Cloverleaf model) | >WENV181524174 Leu TAG c Agtc tttgaaaata G - C C - G G - C G - C G - C T - A G - C T G T T G T C C A T A A G + | | | | A T G G C G G C A G G C G | | | T T G A C G C C A G G TGTCCCCGACGT C - G T - A A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |