Sequence ID | >WENV181531023 |
Genome ID | OGHO01000627 |
Search identical group | |
Phylum/Class | [OGHO] metagenome; Human gut stool |
Species | |
Start position on genome | 5500 |
End posion on genome | 5408 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tcatttccac |
tRNA gene sequence |
GGAGAGGTGGCCGAGACGGCCGAAGGCGCTCGCCTGCTAAGCGGGTATACGGATAAAACT |
Downstream region at tRNA end position |
tatttgtatc |
Secondary structure (Cloverleaf model) | >WENV181531023 Ser GCT c GCCA tatttgtatc G - C G - C A - T G - C A - T G - C G - C T A T C T C C C A C A G A G | | | | | G G G C C G G A G G G C G | | | T T C A G G C C G A G TATACGGATAAAACTGTATC C - G T + G C - G G - C C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |